ycsA

ycsA
168

putative tartrate dehydrogenase

locus
BSU_04000
Molecular weight
38.67 kDa
pI
5.11
Protein length
Gene length
function
unknown
product
putative tartrate dehydrogenase
essential
no
ec
1.1.1.93
synonyms
ycsA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0473

This gene is a member of the following regulons

Gene
Coordinates
452,830 → 453,894
The protein
Catalyzed reaction/ biological activity
Tartrate + NAD+ --> oxaloglycolate + NADH (according to UniProt)
Protein family
Isocitrate and isopropylmalate dehydrogenases family (with [protein|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd] and [protein|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB], according to UniProt)
Structure
[PDB|3FMX] (from ''Pseudomonas Putida '', 51% identity)
[AF|P42958]
Paralogous protein(s)
[protein|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB], [protein|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]
Expression and Regulation
Operons
genes
[gene|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|ycsA]
description
[pubmed|22383849]
Open in new tab

[gene|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|ycsA]

2022-08-31 19:53:07

Jstuelk

15

8864ca1fab16c723998e6b25bf842968081cef7b

B3A42A1202123D6BE6DF16C00CA996414473B85F

Biological materials
Mutant
MGNA-C020 (ycsA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2018 NBRP B. subtilis, Japan]
BKE04000 (Δ[gene|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|ycsA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTTCCCCTGTTAT,  downstream forward: _UP4_TGATGAATCAGGCCGGTGGC
BKK04000 (Δ[gene|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|ycsA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTTCCCCTGTTAT,  downstream forward: _UP4_TGATGAATCAGGCCGGTGGC

E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA

Page visits: 937

Time of last update: 2022-10-03 05:26:36

Author of last update: Melvin.boenninger