yobK

yobK
168

antitoxin

locus
BSU_18990
Molecular weight
17.57 kDa
pI
3.97
Protein length
Gene length
function
inhibition of the cytotoxic activity of [protein|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]
product
antitoxin
essential
no
synonyms
yobK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,071,286 → 2,071,744
The protein
Structure
[PDB|2PRV]
[AF|O34596]
Expression and Regulation
Operons
genes
[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]-[gene|E9FE0BA3CB7ABF98762F65B619ADC6BE0EC54B4E|yobK]
description
[pubmed|22383849]
Open in new tab

Array

2022-11-23 02:54:09

Jstuelk

31

F33DB81D4A94EFC7E3A2571A1742607CF3C89F3E

F33DB81D4A94EFC7E3A2571A1742607CF3C89F3E

Biological materials
Mutant
MGNA-A308 (yobK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/308 NBRP B. subtilis, Japan]
BKE18990 (Δ[gene|E9FE0BA3CB7ABF98762F65B619ADC6BE0EC54B4E|yobK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCGAATAAATCATATAAA,  downstream forward: _UP4_TAAGCAAAAGTATTGCTATA
BKK18990 (Δ[gene|E9FE0BA3CB7ABF98762F65B619ADC6BE0EC54B4E|yobK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCGAATAAATCATATAAA,  downstream forward: _UP4_TAAGCAAAAGTATTGCTATA
References
22200572,34280190

E9FE0BA3CB7ABF98762F65B619ADC6BE0EC54B4E

Page visits: 1593

Time of last update: 2022-11-25 22:08:14

Author of last update: Jstuelk