SubtiWiki SubtiWiki
yesL

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yesL
168

unknown

locus
BSU_06940
Molecular weight
23.29 kDa
pI
10.25
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yesL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5578

This gene is a member of the following regulons

Gene
Coordinates
758,093 → 758,722
The protein
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|EA17F9BBA4473C714711EB7577044402CD38B59C|yesL]-[gene|4A0961B9B760D4AA968B750ECE634B13039F9FC5|yesM]-[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]
description
[pubmed|22383849]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|EA17F9BBA4473C714711EB7577044402CD38B59C|yesL]->[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]

2022-01-24 23:07:39

Bzhu

6

0a0856680046f4a9a13db901ea1db74d20547b9b

13801837B9137F1D6F2BEE3267F800035E9436AB

Biological materials
Mutant
MGNA-A957 (yesL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/957 NBRP B. subtilis, Japan]
BKE06940 (Δ[gene|EA17F9BBA4473C714711EB7577044402CD38B59C|yesL]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACCTTCCTGCTTTGGA,  downstream forward: _UP4_GCATGAAGAAAAGAGTTGCT
BKK06940 (Δ[gene|EA17F9BBA4473C714711EB7577044402CD38B59C|yesL]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACCTTCCTGCTTTGGA,  downstream forward: _UP4_GCATGAAGAAAAGAGTTGCT

EA17F9BBA4473C714711EB7577044402CD38B59C

Page visits: 1224

Time of last update: 2022-01-26 21:00:09

Author of last update: Melvin.boenninger