adhB

adhB
168

forespore-specific protein, similar to alcohol dehydrogenase

locus
BSU_26970
Molecular weight
41.04 kDa
pI
5.66
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
adhB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1063

This gene is a member of the following regulons

Gene
Coordinates
2,753,452 → 2,754,588
The protein
Protein family
[wiki|zinc-containing alcohol dehydrogenase family] (according to UniProt)
Structure
[PDB|4CPD] (from Thermus Sp., 34% identity)
[AF|O06012]
Modification
CoA is attached to Cys-150 in spores [pubmed|33206970]
Paralogous protein(s)
[protein|7F4C5AD47D167683F96CC2841039512E70CC4F1C|yycR], (33%),alcohol dehydrogenase
[wiki|Localization]
spore wall (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]-[gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]-[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]-[gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]-[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]→[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]

2023-02-05 08:41:10

ghost

47

d7b65b29af87b17d60d957745dbcb60005e27aaf

1230FD48E94D5C4C5D5DC8D83656D0C540213821

Biological materials
Mutant
MGNA-A261 (adhB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/261 NBRP B. subtilis, Japan]
BKE26970 (Δ[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTAAAACCTCCAGT,  downstream forward: _UP4_CCTTAAAAAACGGAGGTTAC
BKK26970 (Δ[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTAAAACCTCCAGT,  downstream forward: _UP4_CCTTAAAAAACGGAGGTTAC
References
16497325,33206970

EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE

Page visits: 1680

Time of last update: 2023-02-05 16:19:48

Author of last update: Jstuelk