SubtiWiki SubtiWiki
adhB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

adhB
168

forespore-specific protein, similar to alcohol dehydrogenase

locus
BSU_26970
Molecular weight
41.04 kDa
pI
5.66
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
adhB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1063

This gene is a member of the following regulons

Gene
Coordinates
2,753,452 → 2,754,588
The protein
Protein family
[wiki|zinc-containing alcohol dehydrogenase family] (according to UniProt)
Structure
[PDB|4CPD] (from Thermus Sp., 34% identity)
Modification
CoA is attached to Cys-150 in spores [pubmed|33206970]
Paralogous protein(s)
[protein|7F4C5AD47D167683F96CC2841039512E70CC4F1C|yycR], (33%),alcohol dehydrogenase
[wiki|Localization]
spore wall (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]-[gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]-[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]-[gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]-[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]→[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]

2021-09-18 05:52:25

ghost

8

d7b65b29af87b17d60d957745dbcb60005e27aaf

1230FD48E94D5C4C5D5DC8D83656D0C540213821

Biological materials
Mutant
MGNA-A261 (adhB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/261 NBRP B. subtilis, Japan]
BKE26970 (Δ[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTAAAACCTCCAGT,  downstream forward: _UP4_CCTTAAAAAACGGAGGTTAC
BKK26970 (Δ[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTAAAACCTCCAGT,  downstream forward: _UP4_CCTTAAAAAACGGAGGTTAC
References
16497325,33206970

EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE

Page visits: 1312

Time of last update: 2021-09-21 07:47:28

Author of last update: Jstuelk