yxeD

yxeD
168

sporulation protein

locus
BSU_39590
Molecular weight
13.49 kDa
pI
6.39
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yxeD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,066,210 → 4,066,563
The protein
Structure
[AF|P54943]
Expression and Regulation
Operons
genes
[gene|EB1C3DD517FA7990BACDDF7C2EED9054A7FBC771|yxeD]
description
[Pubmed|10746760]
regulation
expressed during sporulation ([protein|search|SigE], [protein|search|SigG]) [Pubmed|15699190,16497325]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|EB1C3DD517FA7990BACDDF7C2EED9054A7FBC771|yxeD]

2022-12-16 18:59:20

ghost

17

248a6ac52ca3cd667228e95d0fef843acddc6028

25580A0127D0A09F89717ECF39210F1108CDCF18

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
MGNA-B777 (yxeD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1776 NBRP B. subtilis, Japan]
BKE39590 (Δ[gene|EB1C3DD517FA7990BACDDF7C2EED9054A7FBC771|yxeD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATGATCCCTCCATGT,  downstream forward: _UP4_TAACATATAAAAAGCTCAAC
BKK39590 (Δ[gene|EB1C3DD517FA7990BACDDF7C2EED9054A7FBC771|yxeD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATGATCCCTCCATGT,  downstream forward: _UP4_TAACATATAAAAAGCTCAAC
References
15699190,16497325,10746760,220817675,30782632

EB1C3DD517FA7990BACDDF7C2EED9054A7FBC771

Page visits: 1563

Time of last update: 2023-02-05 21:12:10

Author of last update: Jstuelk