sacY

sacY
168

transcriptional antiterminator for [gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB] and [gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]-[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY] (acts at high sucrose concentrations)

locus
BSU_38420
Molecular weight
32.31 kDa
pI
5.88
Protein length
Gene length
function
regulation of sucrose utilization
product
transcriptional antiterminator
essential
no
synonyms
sacY, ipa-13r, sacS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3711

This gene is a member of the following regulons

Gene
Coordinates
3,943,667 → 3,944,509
The protein
Catalyzed reaction/ biological activity
binding to the mRNA of [gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB] ([gene|93B88FC045122E12715EDEB055C00B2337D5BF70|sacB leader RNA]) and the [gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]-[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY] operon ([gene|search|sacX leader RNA]), causes transcription antitermination (in presence of sucrose)
Protein family
[wiki|PRD-containing transcription factors]
[wiki|Domains]
N-terminal RNA binding domain [Pubmed|10610766]
2 x [wiki|PRD] ([protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI] regulation domains) [Pubmed|9663674]
2 [wiki|PRD] domains (aa 64-169, aa 170-280) (according to UniProt)
Structure
[PDB|1H99] ([protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT] [wiki|PRD]s, 36% identity) [pubmed|11447120]
[PDB|1AUU] (RNA-binding domain)
[AF|P15401]
Paralogous protein(s)
[protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT], [protein|6796E1C147AA21E919A42A953884DC24E182F430|sacT], [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]
Expression and Regulation
Operons
genes
[gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]-[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]
description
[Pubmed|2116367]
regulation
induction by sucrose (at high concentration) [Pubmed|8535520]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|1400159], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]: antitermination, in [regulon|protein:EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1400159], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]→[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]

2022-11-19 18:24:49

ghost

30

71b8be28ad46269e23e5788d9176f974f9403a5a

B12CDDD44C2FA327FE195497E0BB83EF99EBC6D4

Biological materials
Mutant
GP425 (cat), available in [wiki|Jörg Stülke]'s lab
BKE38420 (Δ[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTTTGTCCTTTC,  downstream forward: _UP4_TGAGACAAACAAAAAACGCT
BKK38420 (Δ[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTTTGTCCTTTC,  downstream forward: _UP4_TGAGACAAACAAAAAACGCT
Expression vectors
for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP316, available in [wiki|Jörg Stülke]'s lab
for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [wiki|pGP570]: pGP573, available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1222 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
GFP fusion
GP1226 (spc, based on [wiki|pGP1870]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
References
Reviews
9663674,18086213
Original Publications
2105292,8702561,11580842,1279678,9305643,9305644,9202047,10610766,2116367,1400159,8535520,21278164,23303779,12079345

EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344

Page visits: 2283

Time of last update: 2022-11-27 10:56:02

Author of last update: Jstuelk