SubtiWiki SubtiWiki
ywrK

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ywrK
168

similar to arsenical pump membrane protein

locus
BSU_36030
Molecular weight
49.38 kDa
pI
9.65
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ywrK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1055

This gene is a member of the following regulons

Gene
Coordinates
3,712,617 → 3,713,945
The protein
Protein family
ArsB family (with [protein|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA], according to UniProt)
Paralogous protein(s)
[protein|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]-[gene|EB8E3F88BC1ED2BAD5A98D609EDAA002261150A5|ywrK]
description
[Pubmed|22383849]
Open in new tab

[gene|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]→[gene|EB8E3F88BC1ED2BAD5A98D609EDAA002261150A5|ywrK]

2021-11-05 08:51:27

Jstuelk

6

0c4c9296f621b434a75faa015427e4c02d6b9b1d

AA138F6CC87F971586EBC682344D0BD8D693627E

genes
[gene|EB8E3F88BC1ED2BAD5A98D609EDAA002261150A5|ywrK]
description
[Pubmed|22383849]
Open in new tab

[gene|EB8E3F88BC1ED2BAD5A98D609EDAA002261150A5|ywrK]

2021-12-11 10:56:47

Jstuelk

8

24d21d523270e8959b8e11e645fb3db932edca27

FDFE081528C21683B58F1F27AA1FF52C06DB3DBE

Biological materials
Mutant
MGNA-A573 (ywrK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/573 NBRP B. subtilis, Japan]
BKE36030 (Δ[gene|EB8E3F88BC1ED2BAD5A98D609EDAA002261150A5|ywrK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTGAATATGCCGGTGA,  downstream forward: _UP4_TAGCACAGTATGAAACGAAA
BKK36030 (Δ[gene|EB8E3F88BC1ED2BAD5A98D609EDAA002261150A5|ywrK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTGAATATGCCGGTGA,  downstream forward: _UP4_TAGCACAGTATGAAACGAAA
References
27766092

EB8E3F88BC1ED2BAD5A98D609EDAA002261150A5

Page visits: 941

Time of last update: 2022-01-12 17:03:08

Author of last update: Melvin.boenninger