yaaT

yaaT
168

subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex, required for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] dependent maturation of polycistronic mRNAs, control of the [wiki|phosphorelay], required for the achieving a sufficient level of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]-P for [wiki|sporulation] initiation

locus
BSU_00320
Molecular weight
31.07 kDa
pI
4.84
Protein length
Gene length
function
control of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] activity, see [wiki|Targets of the Y complex]
product
subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex
essential
no
synonyms
yaaT, ricT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1774

This gene is a member of the following regulons

Gene
Coordinates
41,657 → 42,484
Phenotypes of a mutant
block of [wiki|sporulation] at stage 0 [Pubmed|12270811]
strongly reduced [wiki|genetic competence], strongly reduced [wiki|sporulation] [Pubmed|23490197]
defective in [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-mediated maturation of polycistronic mRNAs, see [wiki|Targets of the Y complex] [pubmed|29794222]
defective in [category|SW.4.1.4|Swarming] motility (prolonged period of immotility prior to [category|SW.4.1.4|Swarming]) [pubmed|35638827]
The protein
Catalyzed reaction/ biological activity
the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex acts as specificity factor for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent processing of polycistronic mRNAs, see [wiki|Targets of the Y complex] [pubmed|29794222]
the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex stimulates [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A] phosphorylation in the [category|SW.4.2.2|phosphorelay] [pubmed|27501195]
[wiki|Domains]
PSP1 C-terminal domain (aa 61-146) (according to UniProt)
[wiki|Cofactors]
two 4Fe-4S clusters (fully co-ordinates one cluster and contributes to the co-ordination of the second (with [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA] and [protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF])) [pubmed|31530674,28295778]
Structure
[AF|P37541]
[wiki|Localization]
cytoplasm [pubmed|35326384,27501195]
cell membrane [pubmed|35326384]
cell periphery, depending on [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
Expression and Regulation
Operons
genes
[gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
description
[Pubmed|22383849]
Open in new tab

[gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]→[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]

2022-11-24 03:33:18

Jstuelk

80

adcd0181c3bf7f5a66d1644d176d0c60f2121a3a

87CEB0D67D1455F48A42F665A0B9A91B779AEC5D

genes
[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
description
[Pubmed|22383849]
regulation
expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
Open in new tab

[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]→[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]

2022-11-25 21:07:20

ghost

65

62a125e6301e56c82f6a74dcb70741fe56737f41

DA0A2CE2876D38C223E4BA512D01D105B53BF136

genes
[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
description
[Pubmed|22383849]
Open in new tab

[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]→[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]

2022-11-24 19:40:12

Jstuelk

71

cae86a5ed186d19f5321f28f72d35514a5988afb

E9A27179465E2479F141CE804267881CAB860CC2

additional information
600,000/ 11,500 molecules per cell during growth in LB/ minimal medium [pubmed|31530674]
Biological materials
Mutant
MGNA-B899 (ricT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1898 NBRP B. subtilis, Japan]
BKE00320 (Δ[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00320 BGSC] and in [wiki|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_GACACCAATTACATTGTACA,  downstream forward: _UP4_ACAGATTAACGAGGTGTGGA
BKK00320 (Δ[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GACACCAATTACATTGTACA,  downstream forward: _UP4_ACAGATTAACGAGGTGTGGA
References
Reviews
32061882,32156829,32156813,35638784
Original Publications
12270811,23490197,22383849,26434553,28295778,27501195,29794222,31530674,35326384,35638827

EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4

Page visits: 4506

Time of last update: 2022-11-28 23:40:15

Author of last update: Jstuelk