ybcH

ybcH
168

unknown

locus
BSU_01870
Molecular weight
11.22 kDa
pI
4.99
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybcH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
210,224 → 210,514
The protein
Structure
[AF|O34795]
Expression and Regulation
Operons
genes
[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]-[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]-[gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]-[gene|EBE0360D89E50EEBB84CC853C6E4B4053DBF8925|ybcH]-[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]
description
[Pubmed|22383849]
Open in new tab

[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]→[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]

2022-12-01 03:35:00

Jstuelk

38

e140e954b90890d3138431566447fb6e0403ad92

FF8650333154CD6783C7E2C33588F0F5E9F40953

Biological materials
Mutant
BKE01870 (Δ[gene|EBE0360D89E50EEBB84CC853C6E4B4053DBF8925|ybcH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAATCTCCTTAGAACT,  downstream forward: _UP4_TAATGAGACGAAATCACAAA
BKK01870 (Δ[gene|EBE0360D89E50EEBB84CC853C6E4B4053DBF8925|ybcH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAATCTCCTTAGAACT,  downstream forward: _UP4_TAATGAGACGAAATCACAAA

EBE0360D89E50EEBB84CC853C6E4B4053DBF8925

Page visits: 974

Time of last update: 2022-11-30 23:20:17

Author of last update: Bzhu