recF

recF
168

promoter of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] DNA repair center assembly

locus
BSU_00040
Molecular weight
42.15 kDa
pI
7.01
Protein length
Gene length
function
[category|SW.3.1.5|DNA repair/ recombination]
product
promoter of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] DNA repair center assembly
synonyms
recF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1195

This gene is a member of the following regulons

Gene
Coordinates
3,437 → 4,549
Phenotypes of a mutant
drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
The protein
Catalyzed reaction/ biological activity
increases the efficiency of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] DNA repair center assembly [Pubmed|24891441]
Protein family
RecF family (single member, according to UniProt)
Structure
[PDB|5Z67] (from Thermoanaerobacter tengcongensis, 33% identity) [pubmed|29391496]
[AF|P05651]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]-[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]-[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]-[gene|AA42910B71348EFEA4165CFFCEF1E497897B9DDC|gyrB]-[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2987848], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]→[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]

2022-09-13 21:19:35

Jstuelk

36

7cfa0ee36064fef3f7a603b125c665e7c80f35bd

A6120E836ADBF13F415EC7E80D314C2CE36E1D65

Biological materials
Mutant
GP3529 (Δ[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]::spec), available in [wiki|Jörg Stülke]'s lab
BKE00040 (Δ[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATATACAATCAGTGTCACC,  downstream forward: _UP4_AAGTGAAGAAATGAGGTGAG
BKK00040 (Δ[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATATACAATCAGTGTCACC,  downstream forward: _UP4_AAGTGAAGAAATGAGGTGAG
References
Reviews
22933559,32286623
Original Publications
2987848,15186413,9207023,24285298,24891441,1716726,1909186,8510642,29391496

EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA

Page visits: 2943

Time of last update: 2022-10-03 21:01:38

Author of last update: MBenda