ycbP

ycbP
168

general stress protein

locus
BSU_02590
Molecular weight
13.91 kDa
pI
6.31
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ycbP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
281,769 → 282,155
The protein
Structure
[AF|P42248]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|EC3362AC3EE2595938A429D2839C5E362F514233|ycbP]
description
[pubmed|22383849]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|EC3362AC3EE2595938A429D2839C5E362F514233|ycbP]

2022-11-18 16:42:46

Bzhu

8

18544cba772af2d0bdaa8113c7713b27c70a367c

23097E13D9C588AED1B85CEC1D3C6DD390AF4C6F

Biological materials
Mutant
MGNA-C037 (ycbP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2035 NBRP B. subtilis, Japan]
BKE02590 (Δ[gene|EC3362AC3EE2595938A429D2839C5E362F514233|ycbP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACAATTCCTCCTTTTG,  downstream forward: _UP4_TAATGGAAAGGCCGGTGCTG
BKK02590 (Δ[gene|EC3362AC3EE2595938A429D2839C5E362F514233|ycbP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACAATTCCTCCTTTTG,  downstream forward: _UP4_TAATGGAAAGGCCGGTGCTG
References
15805528

EC3362AC3EE2595938A429D2839C5E362F514233

Page visits: 1094

Time of last update: 2022-12-01 12:28:36

Author of last update: Melvin.boenninger