fpbO

fpbO
168

petrobactin (3.4-catecholate siderophore) [wiki|ABC transporter] (permease)

locus
BSU_03810
Molecular weight
35.32 kDa
pI
9.73
Protein length
Gene length
function
acquisition of iron
product
petrobactin [wiki|ABC transporter] (permease)
essential
no
synonyms
fpbO, yclO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4605

This gene is a member of the following regulons

Gene
Coordinates
433,315 → 434,262
The protein
Catalyzed reaction/ biological activity
uptake of the siderophore petrobactin [Pubmed|19955416]
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|FecCD subfamily] (according to UniProt)
Structure
[AF|P94419]
[wiki|Localization]
cell  membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]-[gene|EC63B5CDFDB4DF3A967ECEC40F2C44849311148B|fpbO]-[gene|473628F86C18FE9957841F3C8B45242C90CB341D|fpbP]-[gene|C1D6D188E5BD039F32427B2A58BBFC0CC173A476|fpbQ]
description
[Pubmed|19955416]
regulation
immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [Pubmed|29133393,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab

[gene|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]→[gene|C1D6D188E5BD039F32427B2A58BBFC0CC173A476|fpbQ]

2022-11-24 10:03:09

Jstuelk

37

74ea5c8bb748d23ec3e0cc6fc1179cb8eab26119

67ED5A2606DC68A56E0956D7F4306EC013902C9F

Biological materials
Mutant
MGNA-C066 (yclO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2064 NBRP B. subtilis, Japan]
BKE03810 (Δ[gene|EC63B5CDFDB4DF3A967ECEC40F2C44849311148B|fpbO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AACGAGCAAAGCTATTTTCA,  downstream forward: _UP4_TTGCTGTTAAAGGAGAATAA
BKK03810 (Δ[gene|EC63B5CDFDB4DF3A967ECEC40F2C44849311148B|fpbO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AACGAGCAAAGCTATTTTCA,  downstream forward: _UP4_TTGCTGTTAAAGGAGAATAA
References
10092453,19955416,12354229,29133393

EC63B5CDFDB4DF3A967ECEC40F2C44849311148B

Page visits: 3113

Time of last update: 2022-12-01 09:03:12

Author of last update: Melvin.boenninger