nasC

nasC
168

nitrate reductase (catalytic subunit)

locus
BSU_03310
Molecular weight
78.39 kDa
pI
6.73
Protein length
Gene length
function
utilization of nitrate
product
nitrate reductase (catalytic subunit)
essential
no
synonyms
nasC, narB, nasBB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3383

This gene is a member of the following regulons

Gene
Coordinates
358,303 → 360,435
The protein
Protein family
[wiki|prokaryotic molybdopterin-containing oxidoreductase family] (according to UniProt)
[wiki|Domains]
[wiki|4Fe-4S Mo/W bis-MGD-type domain] (aa 19-77) (according to UniProt)
[wiki|Cofactors]
MoCo  [Pubmed|11289299]
Fe-S cluster  [Pubmed|11289299]
Structure
[PDB|2IV2] (from E. coli, 32% identity) [pubmed|16830149]
[AF|P42434]
Expression and Regulation
Operons
genes
[gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]-[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]-[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
description
[Pubmed|7836289]
regulation
''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
regulatory mechanism
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|10972836], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [PubMed|8799114,9765565], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|EC6697D5D945B7E5083AFED9218748763C443278|nsrR]: repression, [Pubmed|16885456], in [regulon|protein:EC6697D5D945B7E5083AFED9218748763C443278|nsrR regulon]
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7836289], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]→[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]

2022-11-28 20:04:48

ghost

35

f7e39891ce616efe86a59a87e70448f347bb9239

B3FDABF6DE6A38B053CBE30BA36088850B35E312

Biological materials
Mutant
BKE03310 (Δ[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGCAGTCGTTCAGTCAAAA,  downstream forward: _UP4_TAAATTTTTCATAAAATTTT
BKK03310 (Δ[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGCAGTCGTTCAGTCAAAA,  downstream forward: _UP4_TAAATTTTTCATAAAATTTT
References
Reviews
22103536,11289299
Original Publications
12823818,7868621,25755103,8799114,16885456,16830149

EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5

Page visits: 1566

Time of last update: 2022-11-28 15:52:36

Author of last update: Melvin.boenninger