SubtiWiki SubtiWiki
ywoC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ywoC
168

unknown

locus
BSU_36490
Molecular weight
20.97 kDa
pI
4.62
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ywoC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1335

This gene is a member of the following regulons

Gene
Coordinates
3,755,291 → 3,755,860
The protein
Protein family
[wiki|Isochorismatase family] (according to UniProt)
Structure
[PDB|1J2R] (from E. coli, 46% identity)
Expression and Regulation
Operons
genes
[gene|42FD1230682897172C3D4EA09980E566835EEF34|ywoB]-[gene|ECBA7A0C8E705A464ACF627EBAFF7482EAEE34F2|ywoC]-[gene|856247843F1073833D51F82AB2928CCDC0DA3E64|ywoD]
description
[Pubmed|21856850]
regulation
induced by ramoplanin ([protein|search|YtrA]) [Pubmed|21856850]
regulatory mechanism
[protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]: repression, [Pubmed|21856850], in [regulon|protein:6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21856850], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|42FD1230682897172C3D4EA09980E566835EEF34|ywoB]→[gene|856247843F1073833D51F82AB2928CCDC0DA3E64|ywoD]

2021-08-26 20:41:00

ghost

3

386d2a48eb083e355e489d6fec303556265e4027

0F111A0AE0776936D57ACDFDE89228EB652A95BC

Biological materials
Mutant
MGNA-A932 (ywoC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/932 NBRP B. subtilis, Japan]
BKE36490 (Δ[gene|ECBA7A0C8E705A464ACF627EBAFF7482EAEE34F2|ywoC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGTCTCCTCCTGATAC,  downstream forward: _UP4_GAGTTTCTGGAACAAGTGAA
BKK36490 (Δ[gene|ECBA7A0C8E705A464ACF627EBAFF7482EAEE34F2|ywoC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGTCTCCTCCTGATAC,  downstream forward: _UP4_GAGTTTCTGGAACAAGTGAA

ECBA7A0C8E705A464ACF627EBAFF7482EAEE34F2

Page visits: 773

Time of last update: 2021-10-31 10:53:51

Author of last update: Jstuelk