glpT

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

glpT
168

glycerol-3-phosphate permease

locus
BSU_02140
Molecular weight
49.64 kDa
pI
9.37
Protein length
Gene length
function
glycerol-3-phosphate uptake
product
glycerol-3-phosphate permease
essential
no
synonyms
glpT, ybeE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2271

This gene is a member of the following regulons

Gene
Coordinates
233,994 → 235,328
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[PDB|1PW4] (from E. coli, 60% identity) [pubmed|12893936]
[AF|P37948]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]-[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]
description
[Pubmed|8012593]
regulation
induced by glycerol ([protein|search|GlpP]) [Pubmed|8012593]
regulatory mechanism
[protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]: antitermination, via a protein-dependent [wiki|RNA switch] [Pubmed|8012593], in [regulon|protein:38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP regulon]
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|10913081], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8012593], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]→[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]

2022-04-28 08:50:00

ghost

8

e21fcae2eb545caac4a51ee013af601bc96688aa

3E9AB6EA1D92E82B84D67092560AC5EC28AD9E48

Biological materials
Mutant
QB5437 (ermC), available in the [wiki|Stülke] lab
BKE02140 (Δ[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAATAATTATCCCCCTT,  downstream forward: _UP4_TAAGAAAGACACATAAAAGA
BKK02140 (Δ[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAATAATTATCCCCCTT,  downstream forward: _UP4_TAAGAAAGACACATAAAAGA
References
8012593,12850135,12893936

ECCBD8EF461C24D693450E10EC268DBC7A440618

Page visits: 2252

Time of last update: 2022-05-18 13:23:32

Author of last update: Jstuelk