pgk
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

pgk
168

phosphoglycerate kinase, glycolytic/ gluconeogenic enzyme, universally conserved protein

locus
BSU_33930
Molecular weight
42.03 kDa
pI
4.77
Protein length
Gene length
function
enzyme in glycolysis/ gluconeogenesis
product
phosphoglycerate kinase
essential
No
ec
2.7.2.3
synonyms
pgk

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0126

This gene is a member of the following regulons

Gene
Coordinates
3,480,197 3,481,381
Phenotypes of a mutant
essential [Pubmed|12682299], non-essential according to [Pubmed|23420519]
suppression of ''[gene|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]''(ts) mutation (reverted by addition of pyruvate) [Pubmed|24825009]
poor growth [pubmed|28189581]
poorly transformable [pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
3-phospho-D-glycerate + ATP --> 3-phospho-D-glyceroyl phosphate + ADP (according to UniProt)
Protein family
phosphoglycerate kinase family (single member, according to UniProt)
[wiki|Domains]
nucleotide binding domain (ATP) (350353)
2x substrate binding domain (2123), (5962)
[wiki|Cofactors]
Mg2 or Mn2 [Pubmed|7154941]
Structure
[PDB|1PHP] (from ''Geobacillus stearothermophilus'')
[AF|P40924]
Modification
phosphorylation on Ser-183 AND Thr-299 [Pubmed|17218307], [Pubmed|17726680]
Effectors of protein activity
Inhibited by Co2 , NDP and NMP [Pubmed|7154941]
Kinetic information
Two Substrate Reversible Michaelis-Menten [Pubmed|7154941]
Additional information
extensive information on the structure and enzymatic properties of Pgk can be found at [http://www.proteopedia.org/wiki/index.php/Phosphoglycerate_Kinase Proteopedia]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]-[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]-[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]-[gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]-[gene|C86FB523451AC172A20801829B717E5A5F914211|pgm]-[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]
description
[Pubmed|11489127]
regulation
expression induced by glycolytic intermediates ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]) [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] [Pubmed|11489127]
the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
regulatory mechanism
[protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]: repression, [Pubmed|11489127], in [regulon|protein:ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11489127], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]→[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]

2022-07-08 14:58:26

Jstuelk

37

7b5a04e0f51be88bb9a430514dd0cb9d39ea3a2c

24906FF9311EDEA4AFD94747BD67B2022E642FAB

genes
[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]-[gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]-[gene|C86FB523451AC172A20801829B717E5A5F914211|pgm]-[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]
description
[Pubmed|11489127]
Open in new tab

[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]→[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]

2022-04-29 17:06:05

Jstuelk

23

c718c56bfee7b3945ef7060e9c50614ecf6b1cd7

D821B77CDDBA7B2EDE01B5B3E2E0A964498A261D

Biological materials
Mutant
GP699 (''pgk''::''cat''), available in [wiki|Jrg Stlke]'s lab, [Pubmed|23420519]lab
GP707 (''pgk''::''erm''), available in [wiki|Jrg Stlke]'s lab, [Pubmed|23420519]
BKK33930 ([gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTAGGAGATCCTCCT, downstream forward: _UP4_TAATCTCAAAACTGCTATAA
Expression vectors
pGP1102 (N-terminal His-tag, in [wiki|pWH844]), available in [wiki|Jrg Stlke]'s lab
pGP95 (N-terminal Strep-tag, in [wiki|pGP172]), available in [wiki|Jrg Stlke]'s lab
pGP91 (N-terminal Strep-tag, for [wiki|SPINE], expression in ''B. subtilis'', in [wiki|pGP380]), available in [wiki|Jrg Stlke]'s lab, [pubmed|19193632]
pGP1513 (expression in ''B. subtilis'', in [wiki|pBQ200]), available in [wiki|Jrg Stlke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available iin [wiki|Jrg Stlke]'s lab, [pubmed|19193632]
lacZ fusion
pGP514 (in [wiki|pAC6]), a series of promoter deletion variants is also available in [wiki|pAC6], available in [wiki|Jrg Stlke]'s lab
References
16479537,12850135,17726680,11489127,17505547,17218307,7154941,12682299,23420519,15378759,24825009,28189581

ECF0F2E906BF94F509817752827CA189AFBE53FE

Page visits: 4863

Time of last update: 2022-08-09 03:46:20

Author of last update: Melvin.boenninger