

C-terminal fragment of the Y family DNA polymerase [protein|A04F698C8836E84991BC875BCB7B1460D8E74A8E|yozK]-[protein|ED0A85A8A5FCD12C99507EB033F88586521A7C47|yobH]

Molecular weight
23.06 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Phenotypes of a mutant
reduced formation of [gene|F1969E4C7BAAF70BCBE570F58350C12A3E417539|rpsB] or [gene|144D952B05EBBFF41EC92DF906543EA00475FE69|rpsE] suppressor mutants after mitomycin treatment [pubmed|34339280]
The protein
Protein family
[wiki|DNA polymerase type-Y family] (according to UniProt)
[wiki|UmuC domain] (aa 1-68) (according to UniProt)
[PDB|4DEZ] (from Mycobacterium smegmatis, 24% identity) [pubmed|22868761]
Expression and Regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
Open in new tab


2022-11-22 11:58:12





Biological materials
MGNA-A306 (yobH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/306 NBRP B. subtilis, Japan]
BKE18930 (Δ[gene|ED0A85A8A5FCD12C99507EB033F88586521A7C47|yobH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCAGGATTCTCTT,  downstream forward: _UP4_TGAGAAGTATCTCAGTTACG
BKK18930 (Δ[gene|ED0A85A8A5FCD12C99507EB033F88586521A7C47|yobH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCAGGATTCTCTT,  downstream forward: _UP4_TGAGAAGTATCTCAGTTACG


Page visits: 1736

Time of last update: 2022-12-03 09:51:12

Author of last update: Jstuelk