gerKA

gerKA
168

nutrient receptor

locus
BSU_03700
Molecular weight
60.22 kDa
pI
5.21
Protein length
Gene length
function
germination response to the combination of glucose, fructose, aspartate, and KCl
product
nutrient receptor
essential
no
synonyms
gerKA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5901

This gene is a member of the following regulons

Gene
Coordinates
420,110 → 421,744
The protein
Protein family
[wiki|GerABKA family] (according to UniProt)
[wiki|Domains]
contains multiple membrane-spanning domains [Pubmed|23335419]
Structure
[PDB|6O59] (from B. megaterium, corresponds to aa 40 ... 299, 53.6% identity) [pubmed|31113879]
[AF|P49939]
Paralogous protein(s)
[protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA], [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD], [protein|3368743E6E03792DB83A38A19989123304DF7560|gerBA], [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]
[wiki|Localization]
outer surface of the inner spore membrane [Pubmed|23335419,21696470]
Additional information
700 molecules are present per spore [Pubmed|23749970]
Expression and Regulation
Operons
genes
[gene|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]-[gene|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC]-[gene|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB]
description
[pubmed|22383849]
regulation
expressed during sporulation ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG], [wiki|SpoVT]) [Pubmed|16707705]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, [Pubmed|16707705], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16707705], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
additional information
700 molecules are present per spore [PubMed|23749970]
Open in new tab

[gene|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]→[gene|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB]

2022-12-29 08:22:13

Jstuelk

23

2621476d83b6d6d9772912d035f86d1791de6cd2

5744A84AC240BED93491E29AB72B18EEE120A73F

Biological materials
Mutant
BKE03700 (Δ[gene|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACACAAATACCTTTCCT,  downstream forward: _UP4_AAAGATTTGGAAGAAGGGGA
BKK03700 (Δ[gene|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACACAAATACCTTTCCT,  downstream forward: _UP4_AAAGATTTGGAAGAAGGGGA
References
16707705,16352818,21696470,23335419,23396907,22343299,16740944,23749970,24752279,26731423,31113879

EDB2F4C132211F01654F2A2ED3D220EC15CE6F22

Page visits: 3105

Time of last update: 2023-02-05 02:52:26

Author of last update: Jstuelk