SubtiWiki SubtiWiki
yhbI

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yhbI
168

similar to transcriptional regulator ([wiki|MarR family])

locus
BSU_08990
Molecular weight
17.46 kDa
pI
8.69
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhbI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
976,569 → 977,033
The protein
Protein family
[wiki|MarR family]
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 1-143) (according to UniProt)
Structure
[PDB|1S3J] ([protein|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR], corresponds to aa 38 - 139 of YhbI, 27% identity)
Expression and Regulation
Operons
genes
[gene|EDDD61CF725449E57C72F63D378F6CD1FAC49ADA|yhbI]-[gene|211C58A92BA2A06A34B1F73BDB68A0F581B942C2|yhbJ]-[gene|93159DC7D5C42CFA54F66F232D73F38957243AB7|yhcA]-[gene|7797B0B66922D51B9D142DD2E5857836E47F015B|yhcB]-[gene|95EED3A91483502CA78067421F678B1EDB965B18|yhcC]
description
[Pubmed|22383849]
additional information
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 4 to 41 min) [PubMed|21815947]
Open in new tab

[gene|EDDD61CF725449E57C72F63D378F6CD1FAC49ADA|yhbI]→[gene|95EED3A91483502CA78067421F678B1EDB965B18|yhcC]

2021-12-30 16:16:03

Jstuelk

8

65b8eed6f6195e33988a759b72502a718556f155

51EDE59EF3FA1E0885DE1370B2F6E6D734862A76

Biological materials
Mutant
MGNA-B469 (yhbI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1468 NBRP B. subtilis, Japan]
BKE08990 (Δ[gene|EDDD61CF725449E57C72F63D378F6CD1FAC49ADA|yhbI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTCCTTTTCACCTCATT,  downstream forward: _UP4_TAAAAACTTCTCACATATTT
BKK08990 (Δ[gene|EDDD61CF725449E57C72F63D378F6CD1FAC49ADA|yhbI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTCCTTTTCACCTCATT,  downstream forward: _UP4_TAAAAACTTCTCACATATTT
References
21815947

EDDD61CF725449E57C72F63D378F6CD1FAC49ADA

Page visits: 1034

Time of last update: 2022-01-10 20:51:35

Author of last update: Melvin.boenninger