

similar to transcriptional regulator ([wiki|MarR family])

Molecular weight
17.46 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

976,569 → 977,033
The protein
Protein family
[wiki|MarR family]
[wiki|HTH marR-type domain] (aa 1-143) (according to UniProt)
[PDB|1S3J] ([protein|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR], corresponds to aa 38 - 139 of YhbI, 27% identity)
Expression and Regulation
additional information
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 4 to 41 min) [PubMed|21815947]
Open in new tab


2022-06-26 05:56:12





Biological materials
MGNA-B469 (yhbI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1468 NBRP B. subtilis, Japan]
BKE08990 (Δ[gene|EDDD61CF725449E57C72F63D378F6CD1FAC49ADA|yhbI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTCCTTTTCACCTCATT,  downstream forward: _UP4_TAAAAACTTCTCACATATTT
BKK08990 (Δ[gene|EDDD61CF725449E57C72F63D378F6CD1FAC49ADA|yhbI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTCCTTTTCACCTCATT,  downstream forward: _UP4_TAAAAACTTCTCACATATTT


Page visits: 1131

Time of last update: 2022-07-02 06:45:04

Author of last update: Melvin.boenninger