
At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!


putative transcriptional regulator ([wiki|MerR family])

Molecular weight
16.25 kDa
Protein length
Gene length
transcriptional regulator ([wiki|MerR family])
yhdQ, cueR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0789

This gene is a member of the following regulons

1,033,458 → 1,033,889
The protein
Protein family
[wiki|MerR family]
[wiki|HTH merR-type domain] (aa 11-79) (according to UniProt)
[PDB|6JGV] (from Pseudomonas putida, corresponds to aa 13 ... 115, 34% identity) [pubmed|31548408]
Expression and Regulation
Open in new tab


2022-04-05 03:16:01





Biological materials
MGNA-B484 (yhdQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1483 NBRP B. subtilis, Japan]
BKE09560 (Δ[gene|EDFAF3AF6F2E7578733D5BF0295AD614070453F4|yhdQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACGTTATAGTTATGAG,  downstream forward: _UP4_TAAAACCATTTTATCTAACA
BKK09560 (Δ[gene|EDFAF3AF6F2E7578733D5BF0295AD614070453F4|yhdQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACGTTATAGTTATGAG,  downstream forward: _UP4_TAAAACCATTTTATCTAACA


Page visits: 2200

Time of last update: 2022-05-19 23:32:37

Author of last update: Jstuelk