yhdQ

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yhdQ
168

putative transcriptional regulator ([wiki|MerR family])

locus
BSU_09560
Molecular weight
16.25 kDa
pI
7.89
Protein length
Gene length
function
unknown
product
transcriptional regulator ([wiki|MerR family])
essential
no
synonyms
yhdQ, cueR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0789

This gene is a member of the following regulons

Gene
Coordinates
1,033,458 → 1,033,889
The protein
Protein family
[wiki|MerR family]
[wiki|Domains]
[wiki|HTH merR-type domain] (aa 11-79) (according to UniProt)
Structure
[PDB|6JGV] (from Pseudomonas putida, corresponds to aa 13 ... 115, 34% identity) [pubmed|31548408]
[AF|O07586]
Expression and Regulation
Operons
genes
[gene|EDFAF3AF6F2E7578733D5BF0295AD614070453F4|yhdQ]-[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]
description
[Pubmed|22383849]
Open in new tab

[gene|EDFAF3AF6F2E7578733D5BF0295AD614070453F4|yhdQ]→[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]

2022-04-05 03:16:01

ghost

13

ca09e60baea58b0b0fd5cf5f205da412921dc57f

EC6ED682C054AA1FE5B70E4649BB4B7C30DA995E

Biological materials
Mutant
MGNA-B484 (yhdQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1483 NBRP B. subtilis, Japan]
BKE09560 (Δ[gene|EDFAF3AF6F2E7578733D5BF0295AD614070453F4|yhdQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACGTTATAGTTATGAG,  downstream forward: _UP4_TAAAACCATTTTATCTAACA
BKK09560 (Δ[gene|EDFAF3AF6F2E7578733D5BF0295AD614070453F4|yhdQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACGTTATAGTTATGAG,  downstream forward: _UP4_TAAAACCATTTTATCTAACA
References
15948947,14663075,18048925,22383849,31548408

EDFAF3AF6F2E7578733D5BF0295AD614070453F4

Page visits: 2199

Time of last update: 2022-05-19 19:25:48

Author of last update: Jstuelk