

high-affinity [wiki|ABC transporter] for zinc (permease)

Molecular weight
30.28 kDa
Protein length
Gene length
zinc uptake
[wiki|ABC transporter] for zinc (permease)
znuB, yceA, adcB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1108

This gene is a member of the following regulons

310,000 → 310,842
Phenotypes of a mutant
reduced genetic competence, can be rescued by the addition of excess zinc [Pubmed|21813502]
reduced expression of the ''[gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|flgN]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]'' operon  [Pubmed|21813502]
The protein
Protein family
ABC-3 integral membrane protein family (with [protein|1B7C4AD6CD0632051A0E8CA57034872D13FF67F9|mntC] and [protein|F7DA077FE47DBB409BE2B1D9F12A9D719C246166|mntD], according to UniProt)
cell membrane (according to UniProt)
Expression and Regulation
induced by zinc starvation ([protein|search|Zur]) [Pubmed|12426338]
regulatory mechanism
[protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|protein:A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12426338], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-11-27 16:43:19





Biological materials
MGNA-B982 (yceA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1981 NBRP B. subtilis, Japan]
BKE02870 (Δ[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACGGCGATCATGCCGC,  downstream forward: _UP4_TAACATGAAAAGCAGTTTTC
BKK02870 (Δ[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACGGCGATCATGCCGC,  downstream forward: _UP4_TAACATGAAAAGCAGTTTTC


Page visits: 2195

Time of last update: 2022-11-29 16:10:12

Author of last update: Robert.warneke