yczI

yczI
168

unknown

locus
BSU_04120
Molecular weight
9.04 kDa
pI
7.17
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yczI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
463,245 → 463,490
The protein
Structure
[AF|P42970]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|EE3EE3287832EA0D05D6DC3C867AF8F4A8EEE13F|yczI]
description
[pubmed|22383849]
Open in new tab

[gene|EE3EE3287832EA0D05D6DC3C867AF8F4A8EEE13F|yczI]

2022-11-15 17:24:58

Jstuelk

8

67330ec2436efa02e6670bf1f96cf65c778d575e

CCE86DE4D14978565A0FFF4071D8888465FA4F6A

Biological materials
Mutant
BKE04120 (Δ[gene|EE3EE3287832EA0D05D6DC3C867AF8F4A8EEE13F|yczI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAGGACCATCCTTCCTT,  downstream forward: _UP4_ACACTTCATATTATATAAAT
BKK04120 (Δ[gene|EE3EE3287832EA0D05D6DC3C867AF8F4A8EEE13F|yczI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAGGACCATCCTTCCTT,  downstream forward: _UP4_ACACTTCATATTATATAAAT

EE3EE3287832EA0D05D6DC3C867AF8F4A8EEE13F

Page visits: 912

Time of last update: 2022-11-27 03:47:32

Author of last update: Melvin.boenninger