mtlF

mtlF
168

mannitol-specific permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIA of the [category|SW.1.2.2|PTS]

locus
BSU_03982
Molecular weight
16.00 kDa
pI
4.496
Protein length
Gene length
function
mannitol uptake and phosphorylation
product
mannitol-specific [category|SW.1.2.2|PTS], EIIA
essential
no
synonyms
mtlF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4668

This gene is a member of the following regulons

Gene
Coordinates
451,185 → 451,616
The protein
Protein family
[category|SW.1.2.2|PTS] permease, fructose/ mannitol family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIA domain] type-2 (aa 2-142) (according to UniProt)
Structure
[PDB|1A3A] (from E. coli, 41% identity) [pubmed|9551558]
[AF|C0H3V2]
Expression and Regulation
Operons
genes
[gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]-[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]-[gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD]
description
[Pubmed|12897001]
regulation
induced by mannitol ([protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]) [Pubmed|20444094]
regulatory mechanism
[protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]: activation, [Pubmed|20444094], in [regulon|protein:1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22014119], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An [wiki|ncRNA|antisense RNA] is predicted for [gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD] [PubMed|20525796]
Open in new tab

[gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]→[gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD]

2022-10-03 16:42:50

Jstuelk

12

5bae19b2d80b020443468ffbe472a91dbcc86cee

F44226BCF3EE1A7B00EEDFF583F5DD4C12739D38

Biological materials
Mutant
BKE03982 (Δ[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03982 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACAATCACTCTCTTTC,  downstream forward: _UP4_GCCATTTTCAACGAGGTGAA
BKK03982 (Δ[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03982 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACAATCACTCTCTTTC,  downstream forward: _UP4_GCCATTTTCAACGAGGTGAA
References
12897001,20444094,9551558

EE4A4336E25F5DCAC89214F55CDE203AB47AA249

Page visits: 1694

Time of last update: 2022-10-03 18:13:20

Author of last update: Melvin.boenninger