gerAA

gerAA
168

nutrient receptor, [wiki|germination] response to L-alanine, triggers premature [wiki|germination] in response to morphological defects during [wiki|sporulation]

locus
BSU_33050
Molecular weight
53.62 kDa
pI
8.8
Protein length
Gene length
function
germination response to L-alanine
product
nutrient receptor
essential
no
synonyms
gerAA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5901

This gene is a member of the following regulons

Gene
Coordinates
3,390,782 → 3,392,230
Phenotypes of a mutant
suppresses the defects of [gene|40BCEB3648585961D22B71BBB4FB62EE4B3E360D|spoVV] mutant spores [pubmed|28605069]
The protein
Catalyzed reaction/ biological activity
transducer the nutrient signal sensed by [protein|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB]
triggers premature [wiki|germination] in response to morphological defects during [wiki|sporulation] [pubmed|28605069]
Protein family
[wiki|GerABKA family] (according to UniProt)
[wiki|Domains]
contains multiple membrane-spanning domains [Pubmed|23335419]
Structure
[PDB|6O59] (from B. megaterium, corresponds to aa 4 ... 256, 34% identity) [pubmed|31113879]
[AF|P07868]
Paralogous protein(s)
[protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD], [protein|3368743E6E03792DB83A38A19989123304DF7560|gerBA], [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ], [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]
[wiki|Localization]
outer surface of the inner spore membrane [Pubmed|23335419,21696470]
Additional information
1,100 molecules are present per spore [Pubmed|23749970]
Expression and Regulation
Operons
genes
[gene|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA]-[gene|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB]-[gene|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|gerAC]
description
[Pubmed|3110007]
regulation
expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG], [wiki|SpoVT]) [Pubmed|16497325,15699190,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
additional information
1,100 molecules are present per spore [PubMed|23749970]
Open in new tab

[gene|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA]→[gene|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|gerAC]

2022-12-29 19:27:39

ghost

44

0b30e2b65ff83889103eaceb2726933679280f16

FB9C2DA86BEDDEDF47C18987147D4007D840E75A

Biological materials
Mutant
BKE33050 (Δ[gene|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGAGGTCACCTCTTATC,  downstream forward: _UP4_AAACCAAAAGAGGTGAATAA
BKK33050 (Δ[gene|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGAGGTCACCTCTTATC,  downstream forward: _UP4_AAACCAAAAGAGGTGAATAA
References
Reviews
27337279
Original Publications
3110007,17573930,12670969,2110996,15774895,16497325,11418573,16352818,8755877,21378181,21378197,21696470,22327596,22493018,22343299,16740944,23335419,23396907,24752279,23749970,24916603,28605069,29856851,31113879,34780301

EEDE6A22E91992ABCA677CAB7917B7168C5CB868

Page visits: 3072

Time of last update: 2023-02-05 15:39:01

Author of last update: Jstuelk