yfmT

yfmT
168

vanillin dehydrogenase

locus
BSU_07350
Molecular weight
53.15 kDa
pI
5.08
Protein length
Gene length
function
unknown
product
vanillin dehydrogenase
essential
no
synonyms
yfmT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

Gene
Coordinates
807,091 → 808,548
The protein
Catalyzed reaction/ biological activity
oxidation of vanillin to vanillic acid [Pubmed|26658822]
benzaldehyde + H2O + NAD+ --> benzoate + 2 H+ + NADH (according to UniProt)
4-hydroxy-3-methoxybenzaldehyde + H2O + NAD+ --> 4-hydroxy-3-methoxybenzoate + 2 H+ + NADH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
Structure
[PDB|4DNG] (from ''Bacillus Subtilis'', 47% identity)
[PDB|3RHH] (from from ''Bacillus halodurans'' C-125 complexed with NADP, 32% identity, 67% similarity)
[AF|O06478]
Paralogous protein(s)
[protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]
Expression and Regulation
Operons
genes
[gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]-[gene|63BCB42FC501B57ABC9FF252AC5D04BB729EA6B9|yfmS]
description
[Pubmed|9141694,15033535]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|15033535], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
additional information
in minimal medium, YfmS is present with 4,200 +/- 800 molecules per cell [PubMed|21515776]
Open in new tab

[gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]→[gene|63BCB42FC501B57ABC9FF252AC5D04BB729EA6B9|yfmS]

2022-11-28 20:41:14

ghost

14

1ecc984aac2b0819e1aa3401111de8ee84edde7b

F5A7965A9921A9579F965D5324320AD715850A5B

Biological materials
Mutant
MGNA-C232 (yfmT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2230 NBRP B. subtilis, Japan]
BKE07350 (Δ[gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTCAGCATCTCCTTTA,  downstream forward: _UP4_TTCCCTTATTAATGAAAAGG
BKK07350 (Δ[gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTCAGCATCTCCTTTA,  downstream forward: _UP4_TTCCCTTATTAATGAAAAGG
labs
[wiki|Josef Altenbuchner]
References
9141694,15033535,26658822

EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D

Page visits: 1344

Time of last update: 2022-12-04 23:34:52

Author of last update: Melvin.boenninger