yfmT

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yfmT
168

vanillin dehydrogenase

locus
BSU_07350
Molecular weight
53.15 kDa
pI
5.08
Protein length
Gene length
function
unknown
product
vanillin dehydrogenase
essential
no
synonyms
yfmT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

Gene
Coordinates
807,091 → 808,548
The protein
Catalyzed reaction/ biological activity
oxidation of vanillin to vanillic acid [Pubmed|26658822]
benzaldehyde + H2O + NAD+ --> benzoate + 2 H+ + NADH (according to UniProt)
4-hydroxy-3-methoxybenzaldehyde + H2O + NAD+ --> 4-hydroxy-3-methoxybenzoate + 2 H+ + NADH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
Structure
[PDB|4DNG] (from ''Bacillus Subtilis'', 47% identity)
[PDB|3RHH] (from from ''Bacillus halodurans'' C-125 complexed with NADP, 32% identity, 67% similarity)
[AF|O06478]
Paralogous protein(s)
[protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]
Expression and Regulation
Operons
genes
[gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]-[gene|63BCB42FC501B57ABC9FF252AC5D04BB729EA6B9|yfmS]
description
[Pubmed|9141694,15033535]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|15033535], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
additional information
in minimal medium, YfmS is present with 4,200 +/- 800 molecules per cell [PubMed|21515776]
Open in new tab

[gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]→[gene|63BCB42FC501B57ABC9FF252AC5D04BB729EA6B9|yfmS]

2022-04-08 02:10:38

ghost

8

1ecc984aac2b0819e1aa3401111de8ee84edde7b

F5A7965A9921A9579F965D5324320AD715850A5B

Biological materials
Mutant
MGNA-C232 (yfmT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2230 NBRP B. subtilis, Japan]
BKE07350 (Δ[gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTCAGCATCTCCTTTA,  downstream forward: _UP4_TTCCCTTATTAATGAAAAGG
BKK07350 (Δ[gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTCAGCATCTCCTTTA,  downstream forward: _UP4_TTCCCTTATTAATGAAAAGG
labs
[wiki|Josef Altenbuchner]
References
9141694,15033535,26658822

EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D

Page visits: 1233

Time of last update: 2022-05-20 14:56:43

Author of last update: Melvin.boenninger