pksS

pksS
168

cytochrome P450, hydroxylase of the polyketide bacillaene produced by the pks cluster

locus
BSU_17230
Molecular weight
43.26 kDa
pI
6.12
Protein length
Gene length
function
polyketide synthesis
product
hydroxylase of the polyketide produced by the pks cluster
essential
no
synonyms
pksS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2124

This gene is a member of the following regulons

Gene
Coordinates
1,858,566 → 1,859,783
The protein
Catalyzed reaction/ biological activity
hydroxylation of dihydrobacillaene [Pubmed|17482575]
Protein family
[wiki|cytochrome P450] family (according to UniProt)
Structure
[PDB|4YZR]
[AF|O31785]
Paralogous protein(s)
[protein|A95C28DEE73AD25E28C45B88A7C03C92835F9705|cypA], [protein|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI], [protein|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|yjiB]
Expression and Regulation
Operons
genes
[gene|EF0F13BB682791E167EFC350BF029B08E8A1F410|pksS]
description
[Pubmed|22383849]
Open in new tab

[gene|EF0F13BB682791E167EFC350BF029B08E8A1F410|pksS]

2022-12-01 05:58:21

Jstuelk

11

2c832edb0ab9c8056377cf6c5c46ea128e2c6653

0D6C1591400D76E78F93C7A40EE54547D72B56DB

Biological materials
Mutant
BKE17230 (Δ[gene|EF0F13BB682791E167EFC350BF029B08E8A1F410|pksS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATTCTCCTCGCCT,  downstream forward: _UP4_TAACATTCAAAACGCCCCCT
BKK17230 (Δ[gene|EF0F13BB682791E167EFC350BF029B08E8A1F410|pksS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATTCTCCTCGCCT,  downstream forward: _UP4_TAACATTCAAAACGCCCCCT
References
17482575,21821766

EF0F13BB682791E167EFC350BF029B08E8A1F410

Page visits: 1588

Time of last update: 2022-11-28 07:03:39

Author of last update: Melvin.boenninger