ykoT

ykoT
168

similar to lipoteichoic acid glycosyltransferase

locus
BSU_13390
Molecular weight
38.36 kDa
pI
9.34
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ykoT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0463

This gene is a member of the following regulons

Gene
Coordinates
1,403,479 → 1,404,492
The protein
Protein family
[wiki|glycosyltransferase 2 family] (according to UniProt)
Structure
[PDB|5EKP] (from Synechocystis sp., 38% identity) [pubmed|26729507]
[AF|O34755]
Paralogous protein(s)
[protein|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|csbB]
[protein|FD76A781162795EAF174B59C0A90D2ED3ACC0AB7|ykcC], (39%)
[wiki|Localization]
cell membrane (heterogeneous) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|6B66E6E138ED70318E5911F310953D8F09FA8719|ykoS]-[gene|EF18470AD2B07755431534B52A8FCE6754FDBA9D|ykoT]
description
[Pubmed|22383849]
regulation
expressed late during [wiki|sporulation] in the forespore ([wiki|SigG], [wiki|SpoVT]) [Pubmed|26577401]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, [Pubmed|26577401], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|26577401], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|6B66E6E138ED70318E5911F310953D8F09FA8719|ykoS]→[gene|EF18470AD2B07755431534B52A8FCE6754FDBA9D|ykoT]

2023-01-21 23:09:47

ghost

164

3278536c2bae558d0e5cbe5926c55a6028787f3a

2C73474FD5BDF1C29496BC0E6A0016FF67BCD1D0

Biological materials
Mutant
MGNA-A777 (ykoT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/777 NBRP B. subtilis, Japan]
BKE13390 (Δ[gene|EF18470AD2B07755431534B52A8FCE6754FDBA9D|ykoT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGACTGTTTCAATCGATATC,  downstream forward: _UP4_TAAACACGGAAAGAGCTGAC
BKK13390 (Δ[gene|EF18470AD2B07755431534B52A8FCE6754FDBA9D|ykoT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGACTGTTTCAATCGATATC,  downstream forward: _UP4_TAAACACGGAAAGAGCTGAC
References
21630458,16479537,22383849,26577401,27185829,26729507

EF18470AD2B07755431534B52A8FCE6754FDBA9D

Page visits: 2644

Time of last update: 2023-02-07 16:42:12

Author of last update: Melvin.boenninger