yhjB

yhjB
168

similar to metabolite permease

locus
BSU_10450
Molecular weight
52.60 kDa
pI
9.63
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhjB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0591

This gene is a member of the following regulons

Gene
Coordinates
1,119,162 → 1,120,631
The protein
Protein family
[wiki|sodium:solute symporter (SSF) (TC 2.A.21) family] (according to UniProt)
Structure
[AF|O07556]
Paralogous protein(s)
[protein|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]
Expression and Regulation
Operons
genes
[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]-[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]
description
[Pubmed|22383849]
regulation
repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
Open in new tab

[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]→[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]

2022-01-24 08:42:55

ghost

13

e20d4e174d61c1f90f304dae861aa32cc0a1c796

ED93356459DED90EC724658D042C236394200D75

Biological materials
Mutant
GP2395 Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::tet available in [wiki|Jörg Stülke]'s lab [pubmed|32743959]
MGNA-B283 (yhjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1282 NBRP B. subtilis, Japan]
BKE10450 (Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCATTCTGCTTCCTCCTT,  downstream forward: _UP4_TAAGCATAAAAAAAGCAATC
BKK10450 (Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCATTCTGCTTCCTCCTT,  downstream forward: _UP4_TAAGCATAAAAAAAGCAATC
References
11948146,22383849

EFA18ACD034D48868CD97470F81F23976DA300DF

Page visits: 1258

Time of last update: 2022-06-24 13:45:45

Author of last update: Jstuelk