ydfI

ydfI
168

two-component response regulator, control of [gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ] expression

locus
BSU_05420
Molecular weight
23.83 kDa
pI
5.38
Protein length
Gene length
function
control of [gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ] expression
product
two-component response regulator
essential
no
synonyms
ydfI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2197

This gene is a member of the following regulons

Gene
Coordinates
588,960 → 589,601
The protein
[wiki|Domains]
[wiki|Response regulatory domain] (aa 3-118) (according to UniProt)
[wiki|HTH luxR-type domain] (aa 142-207) (according to UniProt)
Structure
[PDB|5HEV] ([protein|search|LiaR ]from Enterococcus faecium, 37% identity) [pubmed|27670715]
[AF|P96686]
Modification
phosphorylation by [protein|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|ydfH] on an Asp residue
Paralogous protein(s)
[protein|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|yxjL], [protein|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK], [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR], [protein|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ]
[wiki|Localization]
cytoplasma (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|ydfH]-[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]
description
[Pubmed|15941986]
Open in new tab

[gene|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|ydfH]→[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]

2023-01-28 13:04:48

ghost

35

f26084e95d34ac9ca538739cbbe65845a203d81d

4EECCA8F59C822E9AD4F1E1A51CBD5C226501351

Biological materials
Mutant
MGNA-C148 (ydfI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2146 NBRP B. subtilis, Japan]
BKE05420 (Δ[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGATGGTCATCAACGATTA,  downstream forward: _UP4_TAAACTGCATATTTGAAAAT
BKK05420 (Δ[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGATGGTCATCAACGATTA,  downstream forward: _UP4_TAAACTGCATATTTGAAAAT
References
10094672,15941986,27670715

EFEAF09E4449A022A7323450FDED9458426A0080

Page visits: 1379

Time of last update: 2023-02-04 10:00:17

Author of last update: Christoph.elfmann