yvcD

yvcD
168

unknown

locus
BSU_34810
Molecular weight
55.21 kDa
pI
4.68
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yvcD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,576,165 → 3,577,619
The protein
[wiki|Domains]
three [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[AF|O06968]
Expression and Regulation
Operons
genes
[gene|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|bmrA]-[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]
description
[pubmed|22383849]
regulation
constitutively expressed [Pubmed|21077936]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21077936], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
half-life of the mRNA: 1.5 min [PubMed|21077936]
Open in new tab

[gene|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|bmrA]->[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]

2022-11-28 03:46:02

Bzhu

39

cbb28df201cbb41f921589502974e179e1c5f328

D27A0048010333EF6A841E0CD3BADFB4A82AC446

Biological materials
Mutant
MGNA-B644 (yvcD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1643 NBRP B. subtilis, Japan]
BKE34810 (Δ[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAACTACCCTCCGTTTTA,  downstream forward: _UP4_TAGTAAATTTTAAAGAGTTG
BKK34810 (Δ[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAACTACCCTCCGTTTTA,  downstream forward: _UP4_TAGTAAATTTTAAAGAGTTG
References
16479537

EFF0635A4BBB62558A04BA49195D76234776F943

Page visits: 1557

Time of last update: 2022-12-09 05:00:16

Author of last update: Jstuelk