flgM

flgM
168

anti-[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD], regulation of flagellin, [category|SW.4.1.1|Motility and chemotaxis]

locus
BSU_35430
Molecular weight
9.86 kDa
pI
9.92
Protein length
Gene length
function
control of [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD] activity
product
anti-[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]
essential
no
synonyms
flgM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2747

This gene is a member of the following regulons

Gene
Coordinates
3,640,285 → 3,640,551
Phenotypes of a mutant
defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827]
The protein
Protein family
flgM family (single member, according to UniProt)
Structure
[PDB|1RP3] ([protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[protein|F03144BF8A187C8931938A21433431B8961E8EE7|flgM] complex from ''Aqufex aeolicus'', 34% identity) [Pubmed|15068809]
[AF|P39809]
[wiki|Localization]
secreted and extracellularly degraded by the proteases [protein|F2E3FF41357C672F80012CFE3076F890407B8B4A|epr] and [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|wprA] [Pubmed|25313396]
secretion of FlgM requires the [protein|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]/[protein|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG] basal body proteins, the flagellar type III export apparatus components [protein|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliO], [protein|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP], [protein|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ], [protein|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR], [protein|974FA844E263AA694477992FA50468CB8EFAB807|flhA], and [protein|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB], and the substrate specificity switch regulator [protein|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK] [Pubmed|25313396]
Expression and Regulation
Operons
genes
[gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|flgN]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]-[gene|E5A59D2AF53FA220BA98D9653589A8F0D24F75B8|yviE]-[gene|6A6CBD75DCC33C804F853F47D37773930D398CFE|fliW]-[gene|93F328524989597C7D2329B25E665496C9631E87|csrA]
description
[Pubmed|22383849]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, [Pubmed|8412657], in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|21736639], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|19898538], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8412657], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|8045879], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]→[gene|93F328524989597C7D2329B25E665496C9631E87|csrA]

2023-01-24 04:30:13

Jstuelk

68

F13A7084BCCB15345BC26C03AF15EE753EFDF196

11180672E46D33F7D747E58441ECB10AEE7F8D8B

genes
[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|flgN]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]
description
[Pubmed|21736639]
Open in new tab

[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]→[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]

2023-01-24 04:30:16

ghost

52

ea02f383b0b547b9936fb15477617f2d69313a11

85B60E6460B7DC58F7D89F65555D10DC02C9174C

genes
[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|flgN]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]
description
[Pubmed|8045879]
Open in new tab

[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]→[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]

2023-01-31 13:30:18

ghost

51

54b504e5188fb5cc1a6644d55c8b17ab69ba9d56

BC4D7E6A3A36ACBE2957E285D8B37ED05A361235

Biological materials
Mutant
1A764 (no resistance), [Pubmed|8045879], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A764&Search=1A764 BGSC]
BKE35430 (Δ[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGGATTCCTCTCGCTTT,  downstream forward: _UP4_AAGCAATAAAAAAGGAGAAA
BKK35430 (Δ[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGGATTCCTCTCGCTTT,  downstream forward: _UP4_AAGCAATAAAAAAGGAGAAA
References
Reviews
25251856
Original Publications
8955328,19898538,8412657,8045879,20233303,10207036,8655488,23352839,21736639,25313396,26244495,15068809,29061663,34232062

F03144BF8A187C8931938A21433431B8961E8EE7

Page visits: 2986

Time of last update: 2023-02-07 23:46:38

Author of last update: Christoph.elfmann