yhjC

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yhjC
168

unknown

locus
BSU_10460
Molecular weight
7.25 kDa
pI
7.01
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yhjC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,120,628 → 1,120,828
The protein
Structure
[AF|O07557]
Expression and Regulation
Operons
genes
[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]-[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]
description
[Pubmed|22383849]
regulation
repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
Open in new tab

[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]→[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]

2022-01-24 08:42:55

ghost

13

e20d4e174d61c1f90f304dae861aa32cc0a1c796

ED93356459DED90EC724658D042C236394200D75

Biological materials
Mutant
BKE10460 (Δ[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCCTCCTTCTATT,  downstream forward: _UP4_GAAAATAAAAAGGAGGAAGC
BKK10460 (Δ[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCCTCCTTCTATT,  downstream forward: _UP4_GAAAATAAAAAGGAGGAAGC
References
18083814,12618455,22383849,11948146

F093B021240236AA938C6336AA0B8DC37839F569

Page visits: 1344

Time of last update: 2022-05-19 08:29:56

Author of last update: Bzhu