yesN

yesN
168

two-component response regulator

locus
BSU_06960
Molecular weight
40.50 kDa
pI
6.95
Protein length
Gene length
function
unknown
product
two-component response regulator
essential
no
synonyms
yesN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4753

This gene is a member of the following regulons

Gene
Coordinates
760,452 → 761,558
The protein
[wiki|Domains]
[wiki|Response regulatory domain] (aa 3-120) (according to UniProt)
[wiki|HTH araC/xylS-type domain] (aa 259-361) (according to UniProt)
Structure
[PDB|2JVJ] ([protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F], the [wiki|Response regulatory domain], 28% identity)
[AF|O31517]
Modification
phosphorylated on a Asp residue by [protein|4A0961B9B760D4AA968B750ECE634B13039F9FC5|yesM]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|EA17F9BBA4473C714711EB7577044402CD38B59C|yesL]-[gene|4A0961B9B760D4AA968B750ECE634B13039F9FC5|yesM]-[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]
description
[pubmed|22383849]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|EA17F9BBA4473C714711EB7577044402CD38B59C|yesL]->[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]

2022-06-24 13:50:17

Bzhu

11

0a0856680046f4a9a13db901ea1db74d20547b9b

13801837B9137F1D6F2BEE3267F800035E9436AB

additional information
[protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
Biological materials
Mutant
MGNA-A946 (yesN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/946 NBRP B. subtilis, Japan]
BKE06960 (Δ[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCAGCCAGCAGTATTTTAT,  downstream forward: _UP4_TAGCCATCTCTGTTTTTTTG
BKK06960 (Δ[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCAGCCAGCAGTATTTTAT,  downstream forward: _UP4_TAGCCATCTCTGTTTTTTTG
References
10094672

F09661C8A483D0FC796204102021104A4373F895

Page visits: 1137

Time of last update: 2022-06-24 21:40:52

Author of last update: Jstuelk