rbsD

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

rbsD
168

ribose [wiki|ABC transporter] (membrane protein)

locus
BSU_35930
Molecular weight
14.09 kDa
pI
4.99
Protein length
Gene length
function
ribose uptake
product
ribose [wiki|ABC transporter] (membrane protein)
essential
no
synonyms
rbsD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1869

This gene is a member of the following regulons

Gene
Coordinates
3,703,271 → 3,703,666
The protein
Catalyzed reaction/ biological activity
β-D-ribopyranose --> β-D-ribofuranose (according to UniProt)
Protein family
RbsD / FucU family (single member, according to UniProt)
Structure
[PDB|1OGD] (complex with D-ribose)
[AF|P36946]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]-[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]-[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]-[gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]-[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]
description
[Pubmed|7921236]
regulation
expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|7921236], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|7592460], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7511775], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]→[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]

2022-04-28 00:34:36

ghost

15

ecd23e67fb36c12e46381b0bbd805e52a3ac9a7b

9A76230F5BF071D52DFA7084300C0507E658DAA8

Biological materials
Mutant
BKE35930 (Δ[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCTGTTCAGTATACCGTGTT,  downstream forward: _UP4_CTTTTCTAGAAAGGAAGATG
BKK35930 (Δ[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCTGTTCAGTATACCGTGTT,  downstream forward: _UP4_CTTTTCTAGAAAGGAAGATG
References
10092453,16872404,7592460,12738765,7921236,7511775

F0E6F191FAF8F279462B09BF1FE4C6C752A57803

Page visits: 1789

Time of last update: 2022-05-19 07:26:37

Author of last update: Melvin.boenninger