rbsD

rbsD
168

ribose [wiki|ABC transporter] (membrane protein)

locus
BSU_35930
Molecular weight
14.09 kDa
pI
4.99
Protein length
Gene length
function
ribose uptake
product
ribose [wiki|ABC transporter] (membrane protein)
essential
no
synonyms
rbsD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1869

This gene is a member of the following regulons

Gene
Coordinates
3,703,271 → 3,703,666
The protein
Catalyzed reaction/ biological activity
β-D-ribopyranose --> β-D-ribofuranose (according to UniProt)
Protein family
RbsD / FucU family (single member, according to UniProt)
Structure
[PDB|1OGD] (complex with D-ribose)
[AF|P36946]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]-[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]-[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]-[gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]-[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]
description
[Pubmed|7921236]
regulation
expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|7921236], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|7592460], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7511775], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]→[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]

2022-11-21 08:16:20

ghost

27

ecd23e67fb36c12e46381b0bbd805e52a3ac9a7b

9A76230F5BF071D52DFA7084300C0507E658DAA8

Biological materials
Mutant
BKE35930 (Δ[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCTGTTCAGTATACCGTGTT,  downstream forward: _UP4_CTTTTCTAGAAAGGAAGATG
BKK35930 (Δ[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCTGTTCAGTATACCGTGTT,  downstream forward: _UP4_CTTTTCTAGAAAGGAAGATG
References
10092453,16872404,7592460,12738765,7921236,7511775

F0E6F191FAF8F279462B09BF1FE4C6C752A57803

Page visits: 2207

Time of last update: 2022-12-04 03:36:02

Author of last update: Melvin.boenninger