

preprotein translocase subunit (ATPase)

Molecular weight
81.47 kDa
Protein length
Gene length
protein secretion
preprotein translocase subunit (ATPase)
secDF, secF, secD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0342

This gene is a member of the following regulons

2,826,900 → 2,829,113
Phenotypes of a mutant
reduced [wiki|protein secretion] [pubmed|32111210]
defective in [category|SW.4.1.4|Swarming] motility (prolonged period of immotility prior to [category|SW.4.1.4|Swarming]) [pubmed|35638827]
The protein
Protein family
N-terminal part: SecD/SecF family (single member, according to UniProt)
C-terminal part: SecD/SecF family (single member, according to UniProt)
[PDB|5XAN] (from Deinococcus radiodurans, 32% identity) [pubmed|28467902]
membrane [Pubmed|18763711]
Expression and Regulation
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
Open in new tab


2023-02-01 13:37:56





Biological materials
MGNA-B519 (yrvB::erm), available at the [ NBRP B. subtilis, Japan]
SM-GN3 (''secDF-spc''), available in [wiki|Anne Galinier]'s and [wiki|Boris Görke]'s labs
BKE27650 (Δ[gene|F0E7B6E000A5B06C9023C76F21551E754C8C45BA|secDF]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATGTATATCCTCCCTT,  downstream forward: _UP4_TAAAAAATATCAGGCTGTCC
BKK27650 (Δ[gene|F0E7B6E000A5B06C9023C76F21551E754C8C45BA|secDF]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATGTATATCCTCCCTT,  downstream forward: _UP4_TAAAAAATATCAGGCTGTCC
Original Publications


Page visits: 1817

Time of last update: 2023-02-07 17:42:22

Author of last update: Jstuelk