rbsC

rbsC
168

ribose ABC transporter (permease)

locus
BSU_35950
Molecular weight
33.63 kDa
pI
10.31
Protein length
Gene length
function
ribose uptake
product
ribose ABC transporter (permease)
essential
no
ec
null
synonyms
rbsC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1172

This gene is a member of the following regulons

Gene
Coordinates
3,705,165 → 3,706,133
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
Structure
[AF|P36948]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]-[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]-[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]-[gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]-[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]
description
[Pubmed|7921236]
regulation
expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|7921236], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|7592460], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7511775], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]→[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]

2022-11-21 08:16:20

ghost

27

ecd23e67fb36c12e46381b0bbd805e52a3ac9a7b

9A76230F5BF071D52DFA7084300C0507E658DAA8

Biological materials
Mutant
BKE35950 (Δ[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTACCGCCCTCCCGTG,  downstream forward: _UP4_AAGTCAGCTTAGGAGGGTTT
BKK35950 (Δ[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTACCGCCCTCCCGTG,  downstream forward: _UP4_AAGTCAGCTTAGGAGGGTTT
References
10092453,16872404,7511775,7592460,7921236

F1258E31151E137A850811B0C851D473CEFFD43B

Page visits: 2760

Time of last update: 2022-12-06 04:14:48

Author of last update: Jstuelk