narK

narK
168

nitrite extrusion protein

locus
BSU_37320
Molecular weight
42.80 kDa
pI
10.1
Protein length
Gene length
function
nitrate respiration, nitrite export
product
nitrite extrusion protein
essential
no
synonyms
narK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2223

This gene is a member of the following regulons

Gene
Coordinates
3,832,327 → 3,833,514
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Nitrate/nitrite porter (TC 2.A.1.8) family (with [protein|2DE7BEC614129384779F4C761E0792385DECC563|nasA], according to UniProt)
Structure
[PDB|4JR9] (from E. coli, 25% identity) [pubmed|23665960]
[AF|P46907]
Paralogous protein(s)
[protein|2DE7BEC614129384779F4C761E0792385DECC563|nasA]
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|narK]-[gene|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]
description
[Pubmed|8846791]
regulation
''[protein|search|fnr]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
regulatory mechanism
[protein|EC6697D5D945B7E5083AFED9218748763C443278|nsrR]: repression, [Pubmed|16885456], in [regulon|protein:EC6697D5D945B7E5083AFED9218748763C443278|nsrR regulon]
[protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]: activation, [Pubmed|8846791,16428414], in [regulon|protein:7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8846791], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|narK]→[gene|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]

2022-08-30 19:20:17

ghost

15

238eac5527cfa8f31180009dd7b1e3d43c4bab0b

E61DAB2E4E2621BE034FA4B91DC19527F039482C

Biological materials
Mutant
BKE37320 (Δ[gene|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|narK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGGCTTGCCCCTTTCA,  downstream forward: _UP4_TAACACTGGGGCATTCACAA
BKK37320 (Δ[gene|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|narK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGGCTTGCCCCTTTCA,  downstream forward: _UP4_TAACACTGGGGCATTCACAA
References
Reviews
11289299
Original Publications
16885456,8846791,16428414,18763711,23665960

F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4

Page visits: 1444

Time of last update: 2022-10-03 04:18:51

Author of last update: Melvin.boenninger