ypeB

ypeB
168

[wiki|germination] protein, essential for [protein|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB] assembly in spores

locus
BSU_22920
Molecular weight
51.02 kDa
pI
6.31
Protein length
Gene length
function
assembly of [protein|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]
product
[wiki|germination] protein
essential
no
synonyms
ypeB, joeB, yzuA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5914

This gene is a member of the following regulons

Gene
Coordinates
2,397,765 → 2,399,117
The protein
Protein family
ypeB family (single member, according to UniProt)
[wiki|Domains]
has a membrane-spanning domain in the N-terminal region [Pubmed|23335419]
Structure
[PDB|5BOI] (C-terminal domain of B. megaterium YpeB, aa 211-450, 53% identity) [pubmed|26219275]
[AF|P38490]
[wiki|Localization]
outer surface of the inner spore membrane [Pubmed|23335419]
Expression and Regulation
Operons
genes
[gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]-[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]
description
[Pubmed|15699190,10197998]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,10197998]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,10197998], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]→[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]

2022-12-29 23:08:09

ghost

30

5d74caf239944fb1e30c0e6238601bcbb30b2316

2938A80B9758C9FA23B7F1A8D1FA5325A1915AE5

Biological materials
Mutant
MGNA-A400 (ypeB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/400 NBRP B. subtilis, Japan]
BKE22920 (Δ[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATCACACCTCTTTTT,  downstream forward: _UP4_TAAAAACAGGAGGAAAGGAC
BKK22920 (Δ[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATCACACCTCTTTTT,  downstream forward: _UP4_TAAAAACAGGAGGAAAGGAC
References
15699190,10197998,23335419,23543708,24752279,25384476,10658652,12177332,26731423,26219275,31871031,35638784

F17F7F4330F1B3C609B8E32581DA6EAC6C69752B

Page visits: 2283

Time of last update: 2023-02-05 02:33:38

Author of last update: Jstuelk