yitF

yitF
168

similar to mandelate racemase

locus
BSU_10970
Molecular weight
41.89 kDa
pI
7.53
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yitF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4948

This gene is a member of the following regulons

Gene
Coordinates
1,174,861 → 1,175,976
The protein
Protein family
[wiki|mandelate racemase/muconate lactonizing enzyme family] (according to UniProt)
Structure
[PDB|2GDQ]
[AF|O06741]
Expression and Regulation
Operons
genes
[gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]-[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]) [Pubmed|16497325,15699190]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325,15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]→[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]

2022-12-14 11:50:19

Jstuelk

15

1a7654e00c5d5a0b2d8d71b0ce746268fb284c6b

ACE0D92BED56C545654A63C0D67166D7CDABC35E

Biological materials
Mutant
MGNA-B180 (yitF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1179 NBRP B. subtilis, Japan]
BKE10970 (Δ[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCGTACAATTTTCACACTGG,  downstream forward: _UP4_TAAGCTGGGCCATTTCTTTA
BKK10970 (Δ[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCGTACAATTTTCACACTGG,  downstream forward: _UP4_TAAGCTGGGCCATTTCTTTA
References
16497325,15699190

F1A84EC28BE0E306356A331FD362E3CDAE49A3AB

Page visits: 1172

Time of last update: 2023-02-06 14:36:11

Author of last update: Melvin.boenninger