

similar to dehydrogenase, may be involved in myo-inositol catabolism

Molecular weight
35.01 kDa
Protein length
Gene length
unknown, may be involved in myo-inositol catabolism
iolS, yxbF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0667

This gene is a member of the following regulons

4,085,608 → 4,086,540
The protein
Protein family
[wiki|Aldo/keto reductase family] (according to UniProt)
[PDB|1PZ0] [Pubmed|15019785]
Paralogous protein(s)
[protein|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|yhdN], [protein|B73D729097C00BE6F3C7FF1708738783EE93C6FB|yccK]
[protein|B0897643562CDB25547223CCB9CFD0F9E78710E2|yqkF], (31,4%)
Expression and Regulation
induced by inositol ([protein|search|IolR]) [Pubmed|9226270]
regulatory mechanism
[protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]: repression, [Pubmed|9226270], in [regulon|protein:5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9226270], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-09-07 14:54:38





Biological materials
BKE39780 (Δ[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTGCCTCCTAGAAT,  downstream forward: _UP4_TAAGAAGAAAACAGCCTTCT
BKK39780 (Δ[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTGCCTCCTAGAAT,  downstream forward: _UP4_TAAGAAGAAAACAGCCTTCT
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
[[Ken-ichi Yoshida]], Kobe University, Japan


Page visits: 1482

Time of last update: 2022-09-28 05:11:04

Author of last update: Jstuelk