yqfU

yqfU
168

unknown

locus
BSU_25110
Molecular weight
32.31 kDa
pI
6.26
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yqfU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1284

This gene is a member of the following regulons

Gene
Coordinates
2,592,003 → 2,592,884
The protein
Protein family
[wiki|UPF0750 membrane proteins] (according to UniProt)
Structure
[AF|P54478]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]-[gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]
description
[Pubmed|22383849]
Open in new tab

[gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]→[gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]

2022-12-29 16:54:31

Jstuelk

25

ac60bd45458950d863054ce20cc2dd96eb965f7a

70C58CD30FD55FB5EE42DD20610C4696D9D314B6

Biological materials
Mutant
MGNA-C421 (yqfU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2419 NBRP B. subtilis, Japan]
BKE25110 (Δ[gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAATCTCCTTTCCTGC,  downstream forward: _UP4_TAGGCTTTCATTTACTTTTA
BKK25110 (Δ[gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAATCTCCTTTCCTGC,  downstream forward: _UP4_TAGGCTTTCATTTACTTTTA
References
12486072

F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24

Page visits: 935

Time of last update: 2023-02-06 17:02:08

Author of last update: Melvin.boenninger