yflG

yflG
168

methionine aminopeptidase

locus
BSU_07690
Molecular weight
27.06 kDa
pI
5.58
Protein length
Gene length
function
removal of N-terminal methionine from nascent proteins
product
methionine aminopeptidase
essential
no
synonyms
yflG, mapB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0024

This gene is a member of the following regulons

Gene
Coordinates
839,735 → 840,484
The protein
Catalyzed reaction/ biological activity
Release of N-terminal amino acids, preferentially methionine, from peptides and arylamides (according to UniProt)
Protein family
peptidase M24A family (with [protein|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map], according to UniProt)
Structure
[PDB|1QXW] (from Staphylococcus aureus, 51% identity) [pubmed|14998322]
[AF|O34484]
Paralogous protein(s)
[protein|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]-[gene|FB3A0E7A2428AA374C844C26464FAF8D40ADF142|yflH]-[gene|2BD3B1B122C902C01C88C97F0D5CD20962C9676B|yflI]
description
[Pubmed|22383849,16207374]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
regulatory mechanism
[protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]: repression, (weak and not certain) [Pubmed|16207374], in [regulon|protein:6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16207374], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]→[gene|2BD3B1B122C902C01C88C97F0D5CD20962C9676B|yflI]

2022-11-26 03:31:32

Jstuelk

25

c1614d2c9c5978531b016f43a531f140bbd19647

EE6EE6B0D0F1E44D02EEBF60829D3001D9844453

Biological materials
Mutant
MGNA-C255 (yflG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2253 NBRP B. subtilis, Japan]
BKE07690 (Δ[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCATTCCCGCTTTC,  downstream forward: _UP4_TAAAACACATTCCGGGCTTC
BKK07690 (Δ[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCATTCCCGCTTTC,  downstream forward: _UP4_TAAAACACATTCCGGGCTTC
References
16207374,14998322

F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16

Page visits: 1370

Time of last update: 2022-11-25 16:21:08

Author of last update: Melvin.boenninger