SubtiWiki SubtiWiki
aldX

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

aldX
168

aldehyde dehydrogenase (NAD)

locus
BSU_39860
Molecular weight
49.41 kDa
pI
4.84
Protein length
Gene length
function
unknown
product
aldehyde dehydrogenase (NAD)
essential
no
ec
1.2.1.3
synonyms
aldX, yxaS, yxbE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

Gene
Coordinates
4,093,980 → 4,095,317
The protein
Catalyzed reaction/ biological activity
aldehyde + H2O + NAD+ --> carboxylate + 2 H+ + NADH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
Structure
[PDB|3RHH] (from ''Bacillus halodurans'' C-125 complexed with NADP, 29% identity, 61% similarity)
[PDB|4QGK] (from ''Homo sapiens''(42%))
Paralogous protein(s)
[protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]
Expression and Regulation
Operons
genes
[gene|F3341F205CB939498109D2A54DE842065C488DD5|aldX]
description
[Pubmed|10746760]
Open in new tab

[gene|F3341F205CB939498109D2A54DE842065C488DD5|aldX]

2021-09-15 14:46:33

ghost

1

0c2edcd28014f7ace016383df5a9f9a6578cfd3e

2BE6174FD48B4ABCD0DAA8FDA5429E56D71DCCFD

Biological materials
Mutant
MGNA-B692 (aldX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1691 NBRP B. subtilis, Japan]
BKE39860 (Δ[gene|F3341F205CB939498109D2A54DE842065C488DD5|aldX]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTAAAATCCCCCTCAT,  downstream forward: _UP4_TAATCGCATGATCAAAAGGC
BKK39860 (Δ[gene|F3341F205CB939498109D2A54DE842065C488DD5|aldX]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTAAAATCCCCCTCAT,  downstream forward: _UP4_TAATCGCATGATCAAAAGGC
References
10746760

F3341F205CB939498109D2A54DE842065C488DD5

Page visits: 965

Time of last update: 2022-01-25 13:38:07

Author of last update: Melvin.boenninger