yazB

yazB
168

similar to transcription regulator ([wiki|Xre family])

locus
BSU_00800
Molecular weight
7.42 kDa
pI
6.59
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yazB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1396

This gene is a member of the following regulons

Gene
Coordinates
87,401 → 87,610
The protein
Protein family
[wiki|Xre family]
[wiki|Domains]
[wiki|HTH cro/C1-type domain] (aa 10-64) (according to UniProt)
Structure
[AF|O31417]
Expression and Regulation
Operons
genes
[gene|B189AD3E3D18876E1956763182D835A151727392|pabB]-[gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC]-[gene|FA9539CB701BC47FD4E849FBA6D7B201B27C6104|sul]-[gene|AAE44B4F73C7C02F7DB3574B6169E0DE46F4B787|folB]-[gene|D2B189C6292ACE1B25658B407C284E9A683EAE5B|folK]-[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]-[gene|CE45D56BC413555AF4E7914B5307AD967A358452|yacF]-[gene|24CC89DE55B3C19F80B11D106B9FD241174AE3E4|lysS]
description
[Pubmed|9084182]
regulation
translation repressed by tryptophan ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|9084182]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9084182], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|B189AD3E3D18876E1956763182D835A151727392|pabB]→[gene|24CC89DE55B3C19F80B11D106B9FD241174AE3E4|lysS]

2022-11-25 21:43:51

Jstuelk

34

8c465dd3eec1aaa32d5e91206834f9bb99ef474a

7B9041CE94396BF42D285F7C0EDD3A2544761EEE

Biological materials
Mutant
MGNA-B926 (yazB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1925 NBRP B. subtilis, Japan]
BKE00800 (Δ[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAATCCTTCTTGAGTATAAC,  downstream forward: _UP4_TAGAACAAATGAAAGGAGGA
BKK00800 (Δ[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAATCCTTCTTGAGTATAAC,  downstream forward: _UP4_TAGAACAAATGAAAGGAGGA
References
9084182,23504016

F373EBC35805DC551E8AFF6FDC7E43D5587C4700

Page visits: 1365

Time of last update: 2022-11-23 02:03:50

Author of last update: Melvin.boenninger