feuC

feuC
168

[wiki|ABC transporter ]for the siderophores Fe-enterobactin and Fe-bacillibactin (integral membrane protein)

locus
BSU_01610
Molecular weight
42.91 kDa
pI
10.44
Protein length
Gene length
function
[wiki|acquisition of iron]
product
[wiki|ABC transporter ]for the siderophores Fe-enterobactin and Fe-bacillibactin (integral membrane protein)
essential
no
synonyms
feuC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0609

This gene is a member of the following regulons

Gene
Coordinates
180,344 → 181,354
Phenotypes of a mutant
severe growth inhibition upon addition of subinhibitory concentrations of mirubactin C [pubmed|36312962]
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|FecCD subfamily] (according to UniProt)
Structure
[PDB|4G1U] (heme transporter from Yersinia pestis, 31% identity) [pubmed|23142986]
[AF|P40411]
Paralogous protein(s)
[protein|EC98685EE0E3CE6CE8DC33409481AE96315279AC|fhuG]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]-[gene|57402D137E3D3791CAF0696421224F4E1DC1BA48|feuB]-[gene|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|feuC]-[gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA]
description
[Pubmed|12354229]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [pubmed|29133393]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
[protein|EB28A65CECE994DF2DF486DEACF40F2533703DB0|btr]: activation, in the presence of the co-activators bacillibactin or enterobactin [Pubmed|17725565], in [regulon|protein:EB28A65CECE994DF2DF486DEACF40F2533703DB0|btr regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17725565], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the presence of an iron-responsive element bound by [wiki|CitB] between ''[wiki|feuA]'' and ''[wiki|feuB]'' suggests iron-dependent regulation by [wiki|CitB] [Pubmed|10468622]
Open in new tab

[gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]→[gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA]

2022-12-09 07:46:18

Jstuelk

36

c6ed9c562a4c7db452ebc8903a1989d0bb2f0947

A3C1B309E9C3034B9896B74BA25621D2CF69902F

Other regulations
[protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]: translation control
Biological materials
Mutant
BKE01610 (Δ[gene|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|feuC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGCGATGAACAATGCAT,  downstream forward: _UP4_AAGCAAAAAAAGGGGGAGAA
BKK01610 (Δ[gene|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|feuC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGCGATGAACAATGCAT,  downstream forward: _UP4_AAGCAAAAAAAGGGGGAGAA
References
19746494,16672620,10092453,16889643,17725565,12354229,10468622,29133393,23142986,36312962

F38F6D4841B3044EA0496B3A1C1D484018BDFEA4

Page visits: 2176

Time of last update: 2022-12-09 10:29:46

Author of last update: Jstuelk