yxdJ

yxdJ
168

two-component response regulator ([wiki|OmpR family]), regulation of the ABC transporter [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL]-[protein|4423383A3F6DAFDFA210F4BEEF7D8CBEC674DCEA|yxdM] in response to the cationic antimicrobial peptide, LL-37

locus
BSU_39660
Molecular weight
26.45 kDa
pI
4.94
Protein length
Gene length
function
resistance against toxic peptides
product
two-component response regulator ([wiki|OmpR family])
essential
no
synonyms
yxdJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0745

This gene is a member of the following regulons

Gene
Coordinates
4,072,284 → 4,072,973
The protein
Protein family
[wiki|OmpR family] of two-component response regulators
[wiki|Domains]
[wiki|Response regulatory domain] (aa 3-116) (according to UniProt)
Structure
[PDB|5DCL] (NisR from Streptococcus agalactiae, 41% identity)
[AF|P42421]
Modification
phosphorylated by [protein|F5BB96607452AC38ECF66923DB8758C364FE2F46|yxdK] on an Asp residue
Expression and Regulation
Operons
genes
[gene|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|yxdJ]-[gene|F5BB96607452AC38ECF66923DB8758C364FE2F46|yxdK]
description
[Pubmed|10746760]
Open in new tab

[gene|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|yxdJ]→[gene|F5BB96607452AC38ECF66923DB8758C364FE2F46|yxdK]

2022-11-23 06:18:03

ghost

14

c76296e9310bddd35358eaa89ad1a230129a405b

44273BFA6B2172951C5D6DC21EB86FC3F740762F

Biological materials
Mutant
MGNA-B702 (yxdJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1701 NBRP B. subtilis, Japan]
BKE39660 (Δ[gene|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|yxdJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACTGAACCACTCCCGTT,  downstream forward: _UP4_GGCTACCAGCTGAGGGCGCA
BKK39660 (Δ[gene|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|yxdJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACTGAACCACTCCCGTT,  downstream forward: _UP4_GGCTACCAGCTGAGGGCGCA
References
10094672,17600057,10746760,15289557,21078927,21283517,23504016,26930060

F3C5505E311E6DDABAFA87899F28CF6596CDBA63

Page visits: 2468

Time of last update: 2022-11-29 16:11:05

Author of last update: Melvin.boenninger