phrI

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

phrI
168

response regulator aspartate phosphatase (RapI) regulator

locus
BSU_05020
Molecular weight
4.10 kDa
pI
8.91
Protein length
Gene length
function
control of the transfer of the mobile genetic element ICEBs1
product
phosphatase (RapI) regulator
essential
no
synonyms
phrI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
548,438 → 548,557
The protein
Catalyzed reaction/ biological activity
binds [protein|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI] and inhibits its activity, this results in contiuned repression of the genes for the transfer of the mobile genetic element ICEBs1 by [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR] [Pubmed|17511812]
Protein family
[wiki|phr family] (according to UniProt)
Structure
[AF|O31492]
Expression and Regulation
Operons
genes
[gene|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI]-[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]
description
[Pubmed|11466295]
regulation
induced at high cell density ([wiki|ComA]) [Pubmed|26582911]
regulatory mechanism
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, [Pubmed|26582911], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
sigma factors
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|11466295], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11466295], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI]→[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]

2022-04-27 13:41:53

ghost

17

c6bf4c9c966d856b996319a23cd84edf50ae9036

4330041E5A91F89C1F761867ABD13572DFB6F31C

genes
[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]
description
[Pubmed|11466295]
regulation
induced at high cell density ([wiki|ComA]) [Pubmed|26582911]
Open in new tab

[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]

2022-04-03 20:25:29

ghost

11

1fb4d9689acd56e4c6d134c231434da272d4449b

C4C7DEEA5A8542B8691955437569B4391BEC8167

Biological materials
Mutant
BKE05020 (Δ[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTACTTAAAATCACTGCT,  downstream forward: _UP4_TAGCTTAGATAATTGGAAAA
BKK05020 (Δ[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTACTTAAAATCACTGCT,  downstream forward: _UP4_TAGCTTAGATAATTGGAAAA
References
Reviews
24995588
Original Publications
11466295,17511812,26582911

F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B

Page visits: 1243

Time of last update: 2022-05-17 01:33:32

Author of last update: Melvin.boenninger