

involved in polyketide synthesis, similar to loading acyltransferase

Molecular weight
33.91 kDa
Protein length
Gene length
polyketide synthesis

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3321

This gene is a member of the following regulons

1,785,133 → 1,786,107
The protein
[PDB|4RL1] (from Streptomyces avermitilis, 26% identity) [pubmed|25581064]
Expression and Regulation
expressed during the transition from growth to stationary phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|24187085]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab


2022-09-24 18:40:05





Open in new tab


2022-09-24 18:41:08





Biological materials
BKE17110 (Δ[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTATAACCTTCTTTT,  downstream forward: _UP4_ACACCAGAAAGGAAGTTTAC
BKK17110 (Δ[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTATAACCTTCTTTT,  downstream forward: _UP4_ACACCAGAAAGGAAGTTTAC


Page visits: 1400

Time of last update: 2022-10-01 01:43:50

Author of last update: Jstuelk