

involved in polyketide synthesis

Molecular weight
27.80 kDa
Protein length
Gene length
polyketide synthesis

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1024

This gene is a member of the following regulons

1,792,012 → 1,792,761
The protein
Protein family
[wiki|enoyl-CoA hydratase/isomerase family] (according to UniProt)
[PDB|4Q1G] and [PDB|4Q1H] (wildtype with different buffer components co-crystallized)
[PDB|4Q1I] (A80K)
[PDB|4Q1J] (A230H)
[PDB|4Q1K] (A232K)
Expression and Regulation
expressed during the transition from growth to stationary phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|24187085]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab


2022-06-21 04:56:49





Open in new tab


2022-06-23 22:52:41





Biological materials
BKE17170 (Δ[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGTCCTCCTAACGGT,  downstream forward: _UP4_TAACTGAAAATATATATAAA
BKK17170 (Δ[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGTCCTCCTAACGGT,  downstream forward: _UP4_TAACTGAAAATATATATAAA


Page visits: 1180

Time of last update: 2022-06-25 06:08:13

Author of last update: Melvin.boenninger