cwlP

cwlP
168

cell wall hydrolase of the SP-beta prophage region,

locus
BSU_21350
Molecular weight
252.01 kDa
pI
8.27
Protein length
Gene length
function
cell wall turnover
product
cell wall hydrolase
essential
no
synonyms
cwlP, yomI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1196

This gene is a member of the following regulons

Gene
Coordinates
2,249,154 → 2,256,011
The protein
Catalyzed reaction/ biological activity
hydrolyzes the peptidoglycan and cell wall of ''B. subtilis'' [Pubmed|20980266]
Protein family
transglycosylase Slt family (together with [protein|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|cwlQ]) (according to UniProt)
[wiki|Domains]
contains soluble lytic transglycosylase (SLT) and peptidase M23 domains [Pubmed|20980266]
ten [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[AF|O31976]
[wiki|Localization]
cell membrane (according to Swiss-Prot)
Biological materials
Mutant
BKE21350 (Δ[gene|F43DC974DC71CB5F82DBD9B9D5ACEB49131772DB|cwlP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAGAATCACTTCCTT,  downstream forward: _UP4_TAAGAGTCTGCAAAAGCAGA
BKK21350 (Δ[gene|F43DC974DC71CB5F82DBD9B9D5ACEB49131772DB|cwlP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAGAATCACTTCCTT,  downstream forward: _UP4_TAAGAGTCTGCAAAAGCAGA
References
20980266

F43DC974DC71CB5F82DBD9B9D5ACEB49131772DB

Page visits: 1562

Time of last update: 2022-12-09 04:54:07

Author of last update: Jstuelk